Bioinformatics Recipe Cookbook
Results for FASTQ data quality control: SRR1972973
Completed
•
Runtime 16 seconds
•
updated 5.4 years ago
by
Bioinformatics Admin
Results generated by running the recipe.
Parameters used during the run:
- SRA Run Number:SRR1972973
File List
Files created by the recipe run:
adapter.fa
45 bytes
reads/SRR1972973.trimmed_2P.fq
764.0 KB
reads/SRR1972973.trimmed_2U.fq
22.1 KB
reads/SRR1972973_1.fastq
2.6 MB
reads/SRR1972973_2.fastq
2.6 MB
recipe.sh
1.0 KB
reports/SRR1972973_1_fastqc.html
255.7 KB
reports/SRR1972973_2_fastqc.html
245.4 KB
runlog/input.json
831 bytes
runlog/stderr.txt
2.5 KB
runlog/stdout.txt
336 bytes
Output Messages
Messages printed to the standard output stream:
Read 10000 spots for SRR1972973 Written 10000 spots for SRR1972973 Analysis complete for SRR1972973_1.fastq Analysis complete for SRR1972973_2.fastq Analysis complete for SRR1972973.trimmed_1P.fq Analysis complete for SRR1972973.trimmed_1U.fq Analysis complete for SRR1972973.trimmed_2P.fq Analysis complete for SRR1972973.trimmed_2U.fq
Other Messages
Messages printed to the standard error stream:
Started analysis of SRR1972973_1.fastq Approx 10% complete for SRR1972973_1.fastq Approx 20% complete for SRR1972973_1.fastq Approx 30% complete for SRR1972973_1.fastq Approx 40% complete for SRR1972973_1.fastq Approx 50% complete for SRR1972973_1.fastq Approx 60% complete for SRR1972973_1.fastq Approx 70% complete for SRR1972973_1.fastq Approx 80% complete for SRR1972973_1.fastq Approx 90% complete for SRR1972973_1.fastq Approx 100% complete for SRR1972973_1.fastq Started analysis of SRR1972973_2.fastq Approx 10% complete for SRR1972973_2.fastq Approx 20% complete for SRR1972973_2.fastq Approx 30% complete for SRR1972973_2.fastq Approx 40% complete for SRR1972973_2.fastq Approx 50% complete for SRR1972973_2.fastq Approx 60% complete for SRR1972973_2.fastq Approx 70% complete for SRR1972973_2.fastq Approx 80% complete for SRR1972973_2.fastq Approx 90% complete for SRR1972973_2.fastq Approx 100% complete for SRR1972973_2.fastq TrimmomaticPE: Started with arguments: reads/SRR1972973_1.fastq reads/SRR1972973_2.fastq -baseout reads/SRR1972973.trimmed.fq ILLUMINACLIP:adapter.fa:2:30:5 SLIDINGWINDOW:4:20 Multiple cores found: Using 4 threads Using templated Output files: reads/SRR1972973.trimmed_1P.fq reads/SRR1972973.trimmed_1U.fq reads/SRR1972973.trimmed_2P.fq reads/SRR1972973.trimmed_2U.fq Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC' ILLUMINACLIP: Using 0 prefix pairs, 1 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences Quality encoding detected as phred33 Input Read Pairs: 10000 Both Surviving: 4522 (45.22%) Forward Only Surviving: 5362 (53.62%) Reverse Only Surviving: 93 (0.93%) Dropped: 23 (0.23%) TrimmomaticPE: Completed successfully Started analysis of SRR1972973.trimmed_1P.fq Approx 20% complete for SRR1972973.trimmed_1P.fq Approx 40% complete for SRR1972973.trimmed_1P.fq Approx 65% complete for SRR1972973.trimmed_1P.fq Approx 85% complete for SRR1972973.trimmed_1P.fq Started analysis of SRR1972973.trimmed_1U.fq Approx 15% complete for SRR1972973.trimmed_1U.fq Approx 35% complete for SRR1972973.trimmed_1U.fq Approx 55% complete for SRR1972973.trimmed_1U.fq Approx 75% complete for SRR1972973.trimmed_1U.fq Approx 90% complete for SRR1972973.trimmed_1U.fq Started analysis of SRR1972973.trimmed_2P.fq Approx 20% complete for SRR1972973.trimmed_2P.fq Approx 40% complete for SRR1972973.trimmed_2P.fq Approx 65% complete for SRR1972973.trimmed_2P.fq Approx 85% complete for SRR1972973.trimmed_2P.fq Started analysis of SRR1972973.trimmed_2U.fq
Powered by the
release 2.3.6