Bioinformatics Data Analysis

Results generated by running the recipe.

Parameters used during the run:

  • SRA Run Number:SRR3191542
Output Messages
Messages printed to the standard output stream:
Read 10000 spots for SRR3191542
Written 10000 spots for SRR3191542
Analysis complete for SRR3191542_1.fastq
Analysis complete for SRR3191542_2.fastq
Analysis complete for SRR3191542.trimmed_1P.fq
Analysis complete for SRR3191542.trimmed_1U.fq
Analysis complete for SRR3191542.trimmed_2P.fq
Analysis complete for SRR3191542.trimmed_2U.fq
Other Messages
Messages printed to the standard error stream:
+ N=10000
+ mkdir -p reads
+ fastq-dump --split-files -X 10000 -O reads SRR3191542
+ mkdir -p reports
+ fastqc reads/SRR3191542_1.fastq reads/SRR3191542_2.fastq -o reports
Started analysis of SRR3191542_1.fastq
Approx 10% complete for SRR3191542_1.fastq
Approx 20% complete for SRR3191542_1.fastq
Approx 25% complete for SRR3191542_1.fastq
Approx 40% complete for SRR3191542_1.fastq
Approx 45% complete for SRR3191542_1.fastq
Approx 60% complete for SRR3191542_1.fastq
Approx 65% complete for SRR3191542_1.fastq
Approx 80% complete for SRR3191542_1.fastq
Approx 90% complete for SRR3191542_1.fastq
Approx 100% complete for SRR3191542_1.fastq
Started analysis of SRR3191542_2.fastq
Approx 10% complete for SRR3191542_2.fastq
Approx 20% complete for SRR3191542_2.fastq
Approx 25% complete for SRR3191542_2.fastq
Approx 40% complete for SRR3191542_2.fastq
Approx 45% complete for SRR3191542_2.fastq
Approx 60% complete for SRR3191542_2.fastq
Approx 65% complete for SRR3191542_2.fastq
Approx 80% complete for SRR3191542_2.fastq
Approx 90% complete for SRR3191542_2.fastq
Approx 100% complete for SRR3191542_2.fastq
+ echo '>illumina'
+ echo AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
+ trimmomatic PE reads/SRR3191542_1.fastq reads/SRR3191542_2.fastq -baseout reads/SRR3191542.trimmed.fq ILLUMINACLIP:adapter.fa:2:30:5 SLIDINGWINDOW:4:20
TrimmomaticPE: Started with arguments:
 reads/SRR3191542_1.fastq reads/SRR3191542_2.fastq -baseout reads/SRR3191542.trimmed.fq ILLUMINACLIP:adapter.fa:2:30:5 SLIDINGWINDOW:4:20
Multiple cores found: Using 4 threads
Using templated Output files: reads/SRR3191542.trimmed_1P.fq reads/SRR3191542.trimmed_1U.fq reads/SRR3191542.trimmed_2P.fq reads/SRR3191542.trimmed_2U.fq
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 1 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Quality encoding detected as phred33
Input Read Pairs: 10000 Both Surviving: 9469 (94.69%) Forward Only Surviving: 477 (4.77%) Reverse Only Surviving: 26 (0.26%) Dropped: 28 (0.28%)
TrimmomaticPE: Completed successfully
+ fastqc reads/SRR3191542.trimmed_1P.fq reads/SRR3191542.trimmed_1U.fq reads/SRR3191542.trimmed_2P.fq reads/SRR3191542.trimmed_2U.fq -o reports
Started analysis of SRR3191542.trimmed_1P.fq
Approx 5% complete for SRR3191542.trimmed_1P.fq
Approx 20% complete for SRR3191542.trimmed_1P.fq
Approx 30% complete for SRR3191542.trimmed_1P.fq
Approx 40% complete for SRR3191542.trimmed_1P.fq
Approx 50% complete for SRR3191542.trimmed_1P.fq
Approx 60% complete for SRR3191542.trimmed_1P.fq
Approx 70% complete for SRR3191542.trimmed_1P.fq
Approx 80% complete for SRR3191542.trimmed_1P.fq
Approx 95% complete for SRR3191542.trimmed_1P.fq
Started analysis of SRR3191542.trimmed_1U.fq
Started analysis of SRR3191542.trimmed_2P.fq
Approx 5% complete for SRR3191542.trimmed_2P.fq
Approx 15% complete for SRR3191542.trimmed_2P.fq
Approx 30% complete for SRR3191542.trimmed_2P.fq
Approx 40% complete for SRR3191542.trimmed_2P.fq
Approx 50% complete for SRR3191542.trimmed_2P.fq
Approx 60% complete for SRR3191542.trimmed_2P.fq
Approx 70% complete for SRR3191542.trimmed_2P.fq
Approx 80% complete for SRR3191542.trimmed_2P.fq
Approx 95% complete for SRR3191542.trimmed_2P.fq
Started analysis of SRR3191542.trimmed_2U.fq
+ rm -f reports/SRR3191542_1_fastqc.zip reports/SRR3191542_2_fastqc.zip reports/SRR3191542.trimmed_1P_fastqc.zip reports/SRR3191542.trimmed_1U_fastqc.zip reports/SRR3191542.trimmed_2P_fastqc.zip reports/SRR3191542.trimmed_2U_fastqc.zip

Powered by the release 2.3.6