+ mkdir -p refs
+ ACC=AF086833
+ REF=refs/REFERENCE.fa
+ GFF=refs/ANNOTATIONS.fa
+ GENOME=GENOME.fa
+ BAM=align.bam
+ GLOBAL=global.bam
+ ERR=0.05
+ N=2500
+ bio AF086833 --fetch --fasta --end 3kb
+ cat refs/REFERENCE.fa
+ biosed -filter -target AGGGTGGACAACAGAAGAACA -replace AGGGTGGACAACAGAAGAA
+ R1=read1.fq
+ R2=read2.fq
+ wgsim -N 2500 -e 0.05 -r 0 GENOME.fa read1.fq read2.fq
[wgsim] seed = 1606926907
[wgsim_core] calculating the total length of the reference sequence...
[wgsim_core] 1 sequences, total length: 2998
+ bwa index refs/REFERENCE.fa
[bwa_index] Pack FASTA... 0.00 sec
[bwa_index] Construct BWT for the packed sequence...
[bwa_index] 0.00 seconds elapse.
[bwa_index] Update BWT... 0.00 sec
[bwa_index] Pack forward-only FASTA... 0.00 sec
[bwa_index] Construct SA from BWT and Occ... 0.00 sec
[main] Version: 0.7.17-r1188
[main] CMD: bwa index refs/REFERENCE.fa
[main] Real time: 0.361 sec; CPU: 0.004 sec
+ TAG='@RG\tID:variants\tSM:AF086833\tLB:simulation'
+ bwa mem -R '@RG\tID:variants\tSM:AF086833\tLB:simulation' refs/REFERENCE.fa read1.fq read2.fq
+ samtools sort
[M::bwa_idx_load_from_disk] read 0 ALT contigs
[M::process] read 5000 sequences (350000 bp)...
[M::mem_pestat] # candidate unique pairs for (FF, FR, RF, RR): (0, 2246, 0, 0)
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (466, 499, 533)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (332, 667)
[M::mem_pestat] mean and std.dev: (499.07, 49.62)
[M::mem_pestat] low and high boundaries for proper pairs: (265, 734)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_process_seqs] Processed 5000 reads in 0.116 CPU sec, 0.117 real sec
[main] Version: 0.7.17-r1188
[main] CMD: bwa mem -R @RG\tID:variants\tSM:AF086833\tLB:simulation refs/REFERENCE.fa read1.fq read2.fq
[main] Real time: 0.128 sec; CPU: 0.128 sec
+ bwa mem refs/REFERENCE.fa GENOME.fa
+ samtools sort
[M::bwa_idx_load_from_disk] read 0 ALT contigs
[M::process] read 1 sequences (2998 bp)...
[M::mem_process_seqs] Processed 1 reads in 0.000 CPU sec, 0.002 real sec
[main] Version: 0.7.17-r1188
[main] CMD: bwa mem refs/REFERENCE.fa GENOME.fa
[main] Real time: 0.002 sec; CPU: 0.000 sec
+ samtools index align.bam
+ samtools index global.bam
+ bcftools mpileup -Ou -f refs/REFERENCE.fa align.bam
+ bcftools call -mv -Ov -o bcftools.vcf
Note: none of --samples-file, --ploidy or --ploidy-file given, assuming all sites are diploid
[mpileup] 1 samples in 1 input files
+ freebayes -P 0.1 -f refs/REFERENCE.fa align.bam