Bioinformatics Recipe Cookbook

Results generated by running the recipe.

Parameters used during the run:

  • SRA Run Number:SRR1972975
Output Messages
Messages printed to the standard output stream:
Read 10000 spots for SRR1972975
Written 10000 spots for SRR1972975
Analysis complete for SRR1972975_1.fastq
Analysis complete for SRR1972975_2.fastq
Analysis complete for SRR1972975.trimmed_1P.fq
Analysis complete for SRR1972975.trimmed_1U.fq
Analysis complete for SRR1972975.trimmed_2P.fq
Analysis complete for SRR1972975.trimmed_2U.fq
Other Messages
Messages printed to the standard error stream:
Started analysis of SRR1972975_1.fastq
Approx 10% complete for SRR1972975_1.fastq
Approx 20% complete for SRR1972975_1.fastq
Approx 30% complete for SRR1972975_1.fastq
Approx 40% complete for SRR1972975_1.fastq
Approx 50% complete for SRR1972975_1.fastq
Approx 60% complete for SRR1972975_1.fastq
Approx 70% complete for SRR1972975_1.fastq
Approx 80% complete for SRR1972975_1.fastq
Approx 90% complete for SRR1972975_1.fastq
Approx 100% complete for SRR1972975_1.fastq
Started analysis of SRR1972975_2.fastq
Approx 10% complete for SRR1972975_2.fastq
Approx 20% complete for SRR1972975_2.fastq
Approx 30% complete for SRR1972975_2.fastq
Approx 40% complete for SRR1972975_2.fastq
Approx 50% complete for SRR1972975_2.fastq
Approx 60% complete for SRR1972975_2.fastq
Approx 70% complete for SRR1972975_2.fastq
Approx 80% complete for SRR1972975_2.fastq
Approx 90% complete for SRR1972975_2.fastq
Approx 100% complete for SRR1972975_2.fastq
TrimmomaticPE: Started with arguments:
 reads/SRR1972975_1.fastq reads/SRR1972975_2.fastq -baseout reads/SRR1972975.trimmed.fq ILLUMINACLIP:adapter.fa:2:30:5 SLIDINGWINDOW:4:20
Multiple cores found: Using 4 threads
Using templated Output files: reads/SRR1972975.trimmed_1P.fq reads/SRR1972975.trimmed_1U.fq reads/SRR1972975.trimmed_2P.fq reads/SRR1972975.trimmed_2U.fq
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 1 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Quality encoding detected as phred33
Input Read Pairs: 10000 Both Surviving: 5285 (52.85%) Forward Only Surviving: 4705 (47.05%) Reverse Only Surviving: 5 (0.05%) Dropped: 5 (0.05%)
TrimmomaticPE: Completed successfully
Started analysis of SRR1972975.trimmed_1P.fq
Approx 15% complete for SRR1972975.trimmed_1P.fq
Approx 35% complete for SRR1972975.trimmed_1P.fq
Approx 55% complete for SRR1972975.trimmed_1P.fq
Approx 75% complete for SRR1972975.trimmed_1P.fq
Approx 90% complete for SRR1972975.trimmed_1P.fq
Started analysis of SRR1972975.trimmed_1U.fq
Approx 20% complete for SRR1972975.trimmed_1U.fq
Approx 40% complete for SRR1972975.trimmed_1U.fq
Approx 60% complete for SRR1972975.trimmed_1U.fq
Approx 85% complete for SRR1972975.trimmed_1U.fq
Started analysis of SRR1972975.trimmed_2P.fq
Approx 15% complete for SRR1972975.trimmed_2P.fq
Approx 35% complete for SRR1972975.trimmed_2P.fq
Approx 55% complete for SRR1972975.trimmed_2P.fq
Approx 75% complete for SRR1972975.trimmed_2P.fq
Approx 90% complete for SRR1972975.trimmed_2P.fq
Started analysis of SRR1972975.trimmed_2U.fq

Powered by the release 2.3.6