Bioinformatics Recipe Cookbook

Run Parameters
Parameters used during the run:
No user parameters were set.
File List
Files created by the recipe run:
Output Messages
Messages printed to the standard output stream:

Building a new DB, current time: 10/08/2018 15:33:31
New DB name:   /export/sites/biostar-engine/export/media/jobs/job-ef88abad/xdb/ebola
New DB title:  KM233118.fa
Sequence type: Nucleotide
Keep MBits: T
Maximum file size: 1000000000B
Adding sequences from FASTA; added 1 sequences in 0.00592995 seconds.
*********************************************************
Blastn on the 40bp query
*********************************************************
BLASTN 2.7.1+


Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb
Miller (2000), "A greedy algorithm for aligning DNA sequences", J
Comput Biol 2000; 7(1-2):203-14.



Database: KM233118.fa
           1 sequences; 18,613 total letters



Query= KM233118.1 Zaire ebolavirus isolate Ebola
virus/H.sapiens-wt/SLE/2014/Makona-NM042.3, complete genome

Length=40
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

KM233118.1  Zaire ebolavirus isolate Ebola virus/H.sapiens-wt/SLE...  75.0    1e-17


>KM233118.1 Zaire ebolavirus isolate Ebola virus/H.sapiens-wt/SLE/2014/Makona-NM042.3, 
complete genome
Length=18613

 Score = 75.0 bits (40),  Expect = 1e-17
 Identities = 40/40 (100%), Gaps = 0/40 (0%)
 Strand=Plus/Plus

Query  1   AATCATACCTGGTTTGTTTCAGAGCCATATCACCAAGATA  40
           ||||||||||||||||||||||||||||||||||||||||
Sbjct  1   AATCATACCTGGTTTGTTTCAGAGCCATATCACCAAGATA  40



Lambda      K        H
    1.33    0.621     1.12 

Gapped
Lambda      K        H
    1.28    0.460    0.850 

Effective search space used: 520828


  Database: KM233118.fa
    Posted date:  Oct 8, 2018  3:33 PM
  Number of letters in database: 18,613
  Number of sequences in database:  1



Matrix: blastn matrix 1 -2
Gap Penalties: Existence: 0, Extension: 2.5
*********************************************************
Blastn on the 15bp query:
*********************************************************
BLASTN 2.7.1+


Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb
Miller (2000), "A greedy algorithm for aligning DNA sequences", J
Comput Biol 2000; 7(1-2):203-14.



Database: KM233118.fa
           1 sequences; 18,613 total letters



Query= KM233118.1 Zaire ebolavirus isolate Ebola
virus/H.sapiens-wt/SLE/2014/Makona-NM042.3, complete genome

Length=15


***** No hits found *****



Lambda      K        H
    1.33    0.621     1.12 

Gapped
Lambda      K        H
    1.28    0.460    0.850 

Effective search space used: 93015


  Database: KM233118.fa
    Posted date:  Oct 8, 2018  3:33 PM
  Number of letters in database: 18,613
  Number of sequences in database:  1



Matrix: blastn matrix 1 -2
Gap Penalties: Existence: 0, Extension: 2.5
*********************************************************
Blastn with the 'blastn' task on the 15bp query:
*********************************************************
BLASTN 2.7.1+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: KM233118.fa
           1 sequences; 18,613 total letters



Query= KM233118.1 Zaire ebolavirus isolate Ebola
virus/H.sapiens-wt/SLE/2014/Makona-NM042.3, complete genome

Length=15
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

KM233118.1  Zaire ebolavirus isolate Ebola virus/H.sapiens-wt/SLE...  28.3    2e-04


>KM233118.1 Zaire ebolavirus isolate Ebola virus/H.sapiens-wt/SLE/2014/Makona-NM042.3, 
complete genome
Length=18613

 Score = 28.3 bits (30),  Expect = 2e-04
 Identities = 15/15 (100%), Gaps = 0/15 (0%)
 Strand=Plus/Plus

Query  1   AATCATACCTGGTTT  15
           |||||||||||||||
Sbjct  1   AATCATACCTGGTTT  15



Lambda      K        H
   0.634    0.408    0.912 

Gapped
Lambda      K        H
   0.625    0.410    0.780 

Effective search space used: 74408


  Database: KM233118.fa
    Posted date:  Oct 8, 2018  3:33 PM
  Number of letters in database: 18,613
  Number of sequences in database:  1



Matrix: blastn matrix 2 -3
Gap Penalties: Existence: 5, Extension: 2
*********************************************************
Blastn with the 'blastn-short' task on the 15bp query
Note how many hits it generates!
*********************************************************
BLASTN 2.7.1+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: KM233118.fa
           1 sequences; 18,613 total letters



Query= KM233118.1 Zaire ebolavirus isolate Ebola
virus/H.sapiens-wt/SLE/2014/Makona-NM042.3, complete genome

Length=15
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

KM233118.1  Zaire ebolavirus isolate Ebola virus/H.sapiens-wt/SLE...  30.2    1e-04


>KM233118.1 Zaire ebolavirus isolate Ebola virus/H.sapiens-wt/SLE/2014/Makona-NM042.3, 
complete genome
Length=18613

 Score = 30.2 bits (15),  Expect = 1e-04
 Identities = 15/15 (100%), Gaps = 0/15 (0%)
 Strand=Plus/Plus

Query  1   AATCATACCTGGTTT  15
           |||||||||||||||
Sbjct  1   AATCATACCTGGTTT  15


 Score = 18.3 bits (9),  Expect = 0.39
 Identities = 9/9 (100%), Gaps = 0/9 (0%)
 Strand=Plus/Minus

Query  2     ATCATACCT  10
             |||||||||
Sbjct  9426  ATCATACCT  9418


 Score = 16.4 bits (8),  Expect = 1.6
 Identities = 8/8 (100%), Gaps = 0/8 (0%)
 Strand=Plus/Minus

Query  8     CCTGGTTT  15
             ||||||||
Sbjct  4823  CCTGGTTT  4816


 Score = 16.4 bits (8),  Expect = 1.6
 Identities = 8/8 (100%), Gaps = 0/8 (0%)
 Strand=Plus/Minus

Query  8      CCTGGTTT  15
              ||||||||
Sbjct  11169  CCTGGTTT  11162


 Score = 16.4 bits (8),  Expect = 1.6
 Identities = 8/8 (100%), Gaps = 0/8 (0%)
 Strand=Plus/Minus

Query  3      TCATACCT  10
              ||||||||
Sbjct  13387  TCATACCT  13380


 Score = 16.4 bits (8),  Expect = 1.6
 Identities = 8/8 (100%), Gaps = 0/8 (0%)
 Strand=Plus/Minus

Query  1      AATCATAC  8
              ||||||||
Sbjct  14867  AATCATAC  14860


 Score = 16.4 bits (8),  Expect = 1.6
 Identities = 8/8 (100%), Gaps = 0/8 (0%)
 Strand=Plus/Plus

Query  8     CCTGGTTT  15
             ||||||||
Sbjct  3704  CCTGGTTT  3711


 Score = 16.4 bits (8),  Expect = 1.6
 Identities = 8/8 (100%), Gaps = 0/8 (0%)
 Strand=Plus/Plus

Query  1      AATCATAC  8
              ||||||||
Sbjct  10776  AATCATAC  10783


 Score = 14.4 bits (7),  Expect = 6.2
 Identities = 7/7 (100%), Gaps = 0/7 (0%)
 Strand=Plus/Minus

Query  2     ATCATAC  8
             |||||||
Sbjct  3697  ATCATAC  3691


 Score = 14.4 bits (7),  Expect = 6.2
 Identities = 7/7 (100%), Gaps = 0/7 (0%)
 Strand=Plus/Minus

Query  2     ATCATAC  8
             |||||||
Sbjct  6406  ATCATAC  6400


 Score = 14.4 bits (7),  Expect = 6.2
 Identities = 7/7 (100%), Gaps = 0/7 (0%)
 Strand=Plus/Minus

Query  5     ATACCTG  11
             |||||||
Sbjct  7883  ATACCTG  7877


 Score = 14.4 bits (7),  Expect = 6.2
 Identities = 7/7 (100%), Gaps = 0/7 (0%)
 Strand=Plus/Minus

Query  1     AATCATA  7
             |||||||
Sbjct  9588  AATCATA  9582


 Score = 14.4 bits (7),  Expect = 6.2
 Identities = 7/7 (100%), Gaps = 0/7 (0%)
 Strand=Plus/Minus

Query  7      ACCTGGT  13
              |||||||
Sbjct  10045  ACCTGGT  10039


 Score = 14.4 bits (7),  Expect = 6.2
 Identities = 7/7 (100%), Gaps = 0/7 (0%)
 Strand=Plus/Minus

Query  3      TCATACC  9
              |||||||
Sbjct  11920  TCATACC  11914


 Score = 14.4 bits (7),  Expect = 6.2
 Identities = 7/7 (100%), Gaps = 0/7 (0%)
 Strand=Plus/Minus

Query  7      ACCTGGT  13
              |||||||
Sbjct  12773  ACCTGGT  12767


 Score = 14.4 bits (7),  Expect = 6.2
 Identities = 7/7 (100%), Gaps = 0/7 (0%)
 Strand=Plus/Minus

Query  5      ATACCTG  11
              |||||||
Sbjct  17675  ATACCTG  17669


 Score = 14.4 bits (7),  Expect = 6.2
 Identities = 7/7 (100%), Gaps = 0/7 (0%)
 Strand=Plus/Plus

Query  2    ATCATAC  8
            |||||||
Sbjct  514  ATCATAC  520


 Score = 14.4 bits (7),  Expect = 6.2
 Identities = 7/7 (100%), Gaps = 0/7 (0%)
 Strand=Plus/Plus

Query  1     AATCATA  7
             |||||||
Sbjct  3245  AATCATA  3251


 Score = 14.4 bits (7),  Expect = 6.2
 Identities = 7/7 (100%), Gaps = 0/7 (0%)
 Strand=Plus/Plus

Query  5     ATACCTG  11
             |||||||
Sbjct  5514  ATACCTG  5520


 Score = 14.4 bits (7),  Expect = 6.2
 Identities = 7/7 (100%), Gaps = 0/7 (0%)
 Strand=Plus/Plus

Query  1     AATCATA  7
             |||||||
Sbjct  8112  AATCATA  8118


 Score = 14.4 bits (7),  Expect = 6.2
 Identities = 7/7 (100%), Gaps = 0/7 (0%)
 Strand=Plus/Plus

Query  1     AATCATA  7
             |||||||
Sbjct  9451  AATCATA  9457


 Score = 14.4 bits (7),  Expect = 6.2
 Identities = 7/7 (100%), Gaps = 0/7 (0%)
 Strand=Plus/Plus

Query  4     CATACCT  10
             |||||||
Sbjct  9490  CATACCT  9496


 Score = 14.4 bits (7),  Expect = 6.2
 Identities = 7/7 (100%), Gaps = 0/7 (0%)
 Strand=Plus/Plus

Query  2      ATCATAC  8
              |||||||
Sbjct  11558  ATCATAC  11564


 Score = 14.4 bits (7),  Expect = 6.2
 Identities = 7/7 (100%), Gaps = 0/7 (0%)
 Strand=Plus/Plus

Query  9      CTGGTTT  15
              |||||||
Sbjct  13651  CTGGTTT  13657


 Score = 14.4 bits (7),  Expect = 6.2
 Identities = 7/7 (100%), Gaps = 0/7 (0%)
 Strand=Plus/Plus

Query  7      ACCTGGT  13
              |||||||
Sbjct  14933  ACCTGGT  14939



Lambda      K        H
    1.37    0.711     1.31 

Gapped
Lambda      K        H
    1.37    0.711     1.31 

Effective search space used: 130235


  Database: KM233118.fa
    Posted date:  Oct 8, 2018  3:33 PM
  Number of letters in database: 18,613
  Number of sequences in database:  1



Matrix: blastn matrix 1 -3
Gap Penalties: Existence: 5, Extension: 2


Building a new DB, current time: 10/08/2018 15:33:32
New DB name:   /export/sites/biostar-engine/export/media/jobs/job-ef88abad/xdb/yeast
New DB title:  NC_001133.fa
Sequence type: Nucleotide
Keep MBits: T
Maximum file size: 1000000000B
Adding sequences from FASTA; added 1 sequences in 0.00698996 seconds.
*********************************************************
Blastn with the  on the 80bp query. No hits!!!! Why??????
*********************************************************
BLASTN 2.7.1+


Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb
Miller (2000), "A greedy algorithm for aligning DNA sequences", J
Comput Biol 2000; 7(1-2):203-14.



Database: NC_001133.fa
           1 sequences; 230,218 total letters



Query= NC_001133.9 Saccharomyces cerevisiae S288C chromosome I, complete
sequence

Length=80


***** No hits found *****



Lambda      K        H
    1.33    0.621     1.12 

Gapped
Lambda      K        H
    1.28    0.460    0.850 

Effective search space used: 14732928


  Database: NC_001133.fa
    Posted date:  Oct 8, 2018  3:33 PM
  Number of letters in database: 230,218
  Number of sequences in database:  1



Matrix: blastn matrix 1 -2
Gap Penalties: Existence: 0, Extension: 2.5
*********************************************************
Blastn with the '--dust-no' task on the 80bp query:
*********************************************************
BLASTN 2.7.1+


Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb
Miller (2000), "A greedy algorithm for aligning DNA sequences", J
Comput Biol 2000; 7(1-2):203-14.



Database: NC_001133.fa
           1 sequences; 230,218 total letters



Query= NC_001133.9 Saccharomyces cerevisiae S288C chromosome I, complete
sequence

Length=80
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

NC_001133.9  Saccharomyces cerevisiae S288C chromosome I, complet...  148     2e-38


>NC_001133.9 Saccharomyces cerevisiae S288C chromosome I, complete sequence
Length=230218

 Score = 148 bits (80),  Expect = 2e-38
 Identities = 80/80 (100%), Gaps = 0/80 (0%)
 Strand=Plus/Plus

Query  1   CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACCCACACACACA  60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1   CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACCCACACACACA  60

Query  61  CATCCTAACACTACCCTAAC  80
           ||||||||||||||||||||
Sbjct  61  CATCCTAACACTACCCTAAC  80



Lambda      K        H
    1.33    0.621     1.12 

Gapped
Lambda      K        H
    1.28    0.460    0.850 

Effective search space used: 14732928


  Database: NC_001133.fa
    Posted date:  Oct 8, 2018  3:33 PM
  Number of letters in database: 230,218
  Number of sequences in database:  1



Matrix: blastn matrix 1 -2
Gap Penalties: Existence: 0, Extension: 2.5
Other Messages
Messages printed to the standard error stream:

    

Powered by the release 1.3