Applied Bioinformatics Course Recipes

Results generated by running the recipe.

File List
Files created by the recipe run:
Output Messages
Messages printed to the standard output stream:
>AF086833.2:1000-1030 Ebola virus - Mayinga, Zaire, 1976, complete genome
AGTACATGCAGAGCAAGGACTGATACAATAT
Run,ReleaseDate,LibraryLayout
SRR1972917,2015-04-14 13:59:24,PAIRED
SRR1972918,2015-04-14 13:58:26,PAIRED
Other Messages
Messages printed to the standard error stream:


    

Powered by the release 2.3.6