Read 10000 spots for SRR1759214
Written 10000 spots for SRR1759214
Analysis complete for SRR1759214_1.fastq
Analysis complete for SRR1759214_cutadapt.fq

+ PROJECT=PRJNA272617
+ ADAPTER=TGGAATTCTCGGGTGCCAAGG
+ esearch -db sra -query PRJNA272617
+ efetch -format runinfo
+ pip install csvkit -q
WARNING: pip is being invoked by an old script wrapper. This will fail in a future version of pip.
Please see https://github.com/pypa/pip/issues/5599 for advice on fixing the underlying issue.
To avoid this problem you can invoke Python with '-m pip' instead of running pip directly.
+ cat runinfo.csv
+ sort -t , -k 2,2n
+ grep SRR
+ head -1
+ csvcut -x -c Run,size_MB
+ cut -f 1 -d ,
+ cat ids
+ parallel fastq-dump --split-files -X 10000 '{}'
+ cat ids
+ parallel fastqc '{}_1.fastq'
Started analysis of SRR1759214_1.fastq
Approx 10% complete for SRR1759214_1.fastq
Approx 20% complete for SRR1759214_1.fastq
Approx 30% complete for SRR1759214_1.fastq
Approx 35% complete for SRR1759214_1.fastq
Approx 45% complete for SRR1759214_1.fastq
Approx 55% complete for SRR1759214_1.fastq
Approx 70% complete for SRR1759214_1.fastq
Approx 80% complete for SRR1759214_1.fastq
Approx 90% complete for SRR1759214_1.fastq
Approx 100% complete for SRR1759214_1.fastq
+ cat ids
+ parallel cutadapt -q 10 -b TGGAATTCTCGGGTGCCAAGG '{}_1.fastq' '>' '{.}_cutadapt.fq'
This is cutadapt 2.6 with Python 3.6.7
Command line parameters: -q 10 -b TGGAATTCTCGGGTGCCAAGG SRR1759214_1.fastq
Processing reads on 1 core in single-end mode ...
Finished in 0.09 s (9 us/read; 6.50 M reads/minute).

=== Summary ===

Total reads processed:                  10,000
Reads with adapters:                     9,720 (97.2%)
Reads written (passing filters):        10,000 (100.0%)

Total basepairs processed:       500,000 bp
Quality-trimmed:                     704 bp (0.1%)
Total written (filtered):        241,292 bp (48.3%)

=== Adapter 1 ===

Sequence: TGGAATTCTCGGGTGCCAAGG; Type: variable 5'/3'; Length: 21; Trimmed: 9720 times.
37 times, it overlapped the 5' end of a read
9683 times, it overlapped the 3' end or was within the read

No. of allowed errors:
0-9 bp: 0; 10-19 bp: 1; 20-21 bp: 2

Overview of removed sequences (5')
length	count	expect	max.err	error counts
3	3	156.2	0	3
18	1	0.0	1	1
20	1	0.0	2	0 1
21	32	0.0	2	32



Overview of removed sequences (3' or within)
length	count	expect	max.err	error counts
3	42	156.2	0	42
4	49	39.1	0	49
5	57	9.8	0	57
6	40	2.4	0	40
7	33	0.6	0	33
8	54	0.2	0	54
9	44	0.0	0	44
10	49	0.0	1	48 1
11	39	0.0	1	39
12	56	0.0	1	55 1
13	95	0.0	1	92 3
14	83	0.0	1	83
15	79	0.0	1	76 3
16	237	0.0	1	233 4
17	374	0.0	1	370 4
18	235	0.0	1	227 8
19	157	0.0	1	151 6
20	134	0.0	2	131 3
21	80	0.0	2	76 4
22	62	0.0	2	58 4
23	73	0.0	2	70 3
24	56	0.0	2	53 3
25	75	0.0	2	73 2
26	455	0.0	2	442 13
27	1143	0.0	2	1118 24 1
28	2811	0.0	2	2765 43 3
29	952	0.0	2	930 20 2
30	509	0.0	2	503 6
31	173	0.0	2	166 6 1
32	215	0.0	2	209 4 2
33	176	0.0	2	170 6
34	148	0.0	2	143 5
35	168	0.0	2	161 6 1
36	128	0.0	2	121 7
37	78	0.0	2	78
38	95	0.0	2	88 6 1
39	88	0.0	2	86 2
40	72	0.0	2	70 2
41	92	0.0	2	89 3
42	41	0.0	2	39 2
43	50	0.0	2	49 1
44	40	0.0	2	38 2
45	5	0.0	2	5
46	13	0.0	2	12 1
47	6	0.0	2	6
48	22	0.0	2	20 1 1
+ cat ids
+ parallel fastqc '{.}_cutadapt.fq'
Started analysis of SRR1759214_cutadapt.fq
Approx 5% complete for SRR1759214_cutadapt.fq
Approx 15% complete for SRR1759214_cutadapt.fq
Approx 30% complete for SRR1759214_cutadapt.fq
Approx 40% complete for SRR1759214_cutadapt.fq
Approx 50% complete for SRR1759214_cutadapt.fq
Approx 60% complete for SRR1759214_cutadapt.fq
Approx 70% complete for SRR1759214_cutadapt.fq
Approx 80% complete for SRR1759214_cutadapt.fq
Approx 90% complete for SRR1759214_cutadapt.fq
Approx 100% complete for SRR1759214_cutadapt.fq