Corona Virus Genome Analysis
All Projects

Perform viral genome alignment.

This recipe performs a global, pairwise alignment between two genomes.

Default values for genomes are:

  • MG772933 is the bat SARS-like coronavirus isolate bat-SL-CoVZC45,
  • NC_045512 is the Wuhan seafood market pneumonia virus isolate 2019-nCoV/USA-IL1/2020, complete genome

The output is an alignment file:

MG772933.1         1 ATATT--AGGTTTTTACCTTCCCAGGTAACAAACCAACTAACTCTCGATC     48
                       |||  ||||||.||||||||||||||||||||||||.||||.||||||
NC_045512.2        1 --ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATC     48

MG772933.1        49 TCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGACTGTCAC     98
                     ||||||||||||||||||||||||||||||||||||||||||.|||||||
NC_045512.2       49 TCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCAC     98
...

If you are new to the field and need a guide we recommend the Biostar Handbook.

Recipe Code
Back
Recipe Interface
Back
Interface Preview
Interface preview shows the resulting view of the combined interface elements.
Interface specification
Interface element specification. Shows the code and the resulting interface element.
Double click on an element to insert it into the interface.
Integer values
                        [size]
                        label = "Window size"
                        display = "INTEGER"
                        value = 100
                        range = [1, 100]
                        help = "Selects the smoothing window."
                    
Float values
                        [cutoff]
                        label = "P_Value Cutoff"
                        display = "FLOAT"
                        value = 0.05
                        range = [0, 1]
                        help = "Selects the cutoff."
                    
Text box
                    [sra]
                    label = "Run Number"
                    display = "TEXTBOX"
                    value = "SRR519926"
                    regex = 'SRR\d+'
                    help = "Please provide SRR Run number"
                    
Dropdown menu
                    [color]
                    label = "Select color"
                    display = "DROPDOWN"
                    choices = [ ["R","Red"], ["B","Blue"] ]
                    value = "R"
                    help = "Select a color of your choice"
                    
Check box
                    [validate]
                    label = "Cross Validate"
                    display = "CHECKBOX"
                    value = true
                    help = "Apply cross validation on the results."
                    
Upload Field
                    [file]
                    label = "Upload a file "
                    display = "UPLOAD"
                    help = "Upload a file to analyze"
                    
Pick Data
                    [data]
                    label = "Pick data"
                    source = "PROJECT"
                    help = "Pick data from this project."
                    
Radio Buttons
                    [species]
                    label = "Select species"
                    display = "RADIO"
                    choices = [ ["c","Cat"], ["d","Dog"] ]
                    value = "c"
                    help = "Select the species."
                    
Edit Recipe
Recipe display name
Unique identifier for the recipe.

Determines who can run a recipe.

A detailed explanation of what the recipe does (markdown OK).
Image :
Optional image for the recipe ( 500px Maximum ).
Rank:
Used to order recipes (optional).
Back

Powered by the release 2.1