Corona Virus Genome Analysis
Global alignment of viral genomes

Perform viral genome alignment.

1 result • updated 11 weeks ago by Istvan Albert

Perform viral genome alignment.

This recipe performs a global, pairwise alignment between two genomes.

Default values for genomes are:

  • MG772933 is the bat SARS-like coronavirus isolate bat-SL-CoVZC45,
  • NC_045512 is the Wuhan seafood market pneumonia virus isolate 2019-nCoV/USA-IL1/2020, complete genome

The output is an alignment file:

MG772933.1         1 ATATT--AGGTTTTTACCTTCCCAGGTAACAAACCAACTAACTCTCGATC     48
                       |||  ||||||.||||||||||||||||||||||||.||||.||||||
NC_045512.2        1 --ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATC     48

MG772933.1        49 TCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGACTGTCAC     98
                     ||||||||||||||||||||||||||||||||||||||||||.|||||||
NC_045512.2       49 TCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCAC     98
...

If you are new to the field and need a guide we recommend the Biostar Handbook.

Copy recipe
You need write access to the original recipe to edit.
You need write access to the original recipe to edit.
Recipe Interface Builder
Click the buttons on the right to create new fields.
Interface Editor
Edit the content of each interface element.
You need write access to the original recipe to edit.
Edit Recipe
Recipe display name
Unique identifier for the recipe.

Determines who can run a recipe.

Image :
Optional image for the recipe ( 500px Maximum ).
Rank:
Used to order recipes (optional).

Insert Image

Back

Powered by the release 2.3