Recipe View

This recipe performs data quality control on FASTQ data downloaded from SRA.

3 results • updated 6 months ago by Bioinformatics Admin

This recipe performs data quality control on FASTQ data downloaded from SRA.

For more information see the

Bioinformatics Data Analysis online course
Biostar Handbook for system setup and other information.

# The SRR run number.
SRA={{sra.value}}

# Stop the script on errors.
set -uex

# How many sequences to unpack.
N=10000

# Create directory to store the reads in.
mkdir -p reads

# Download 1000 reads from SRA.
fastq-dump --split-files -X $N -O reads  $SRA

# Make a directory for the fastqc reports
mkdir -p reports

# Run the fastqc report on the sra reads.
fastqc reads/*.fastq -o reports

# Create the adapter sequence used for trimming.
echo ">illumina" > adapter.fa
echo "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" >> adapter.fa

# Run trimmomatic on the data.
trimmomatic PE reads/${SRA}_1.fastq reads/${SRA}_2.fastq -baseout reads/${SRA}.trimmed.fq  ILLUMINACLIP:adapter.fa:2:30:5 SLIDINGWINDOW:4:20

# Run trimmomatic on the trimmed data.
fastqc reads/*.fq -o reports

# Delete the fastqc zip files to reduce clutter.
rm -f reports/*.zip

Back

[sra]
label = "SRA Run Number"
display = "TEXTBOX"
value = "SRR519926"
help = "A SRR Run number"

[settings]
id = 97
recipe_uid = "recipe-fastqc"
uid = "recipe-fastqc"
name = "How to visualize FASTQ data quality"
template = "How_to_visualize_FASTQ_data_quality_bio-data-analysis_97.sh"
image = "How_to_visualize_FASTQ_data_quality_bio-data-analysis_97.png"
project_uid = "bio-data-analysis"
url = "http://localhost8000"
help = "This recipe performs data quality control on FASTQ data downloaded from SRA.\n\nFor more information see the \n\n* [Bioinformatics Data Analysis][link] online course\n* [Biostar Handbook][book] for system setup and other information.\n\n[link]: https://www.biostarhandbook.com/edu/course/4/\n[book]: https://www.biostarhandbook.com/"

Back

Interface preview shows the resulting view of the combined interface elements.

Interface element specification. Shows the code and the resulting interface element.

Double click on an element to insert it into the interface.

Integer values

                        [size]
                        label = "Window size"
                        display = "INTEGER"
                        value = 100
                        range = [1, 100]
                        help = "Selects the smoothing window."

Float values

                        [cutoff]
                        label = "P_Value Cutoff"
                        display = "FLOAT"
                        value = 0.05
                        range = [0, 1]
                        help = "Selects the cutoff."

Text box

                    [sra]
                    label = "Run Number"
                    display = "TEXTBOX"
                    value = "SRR519926"
                    regex = 'SRR\d+'
                    help = "Please provide SRR Run number"

Dropdown menu

                    [color]
                    label = "Select color"
                    display = "DROPDOWN"
                    choices = [ ["R","Red"], ["B","Blue"] ]
                    value = "R"
                    help = "Select a color of your choice"

Check box

                    [validate]
                    label = "Cross Validate"
                    display = "CHECKBOX"
                    value = true
                    help = "Apply cross validation on the results."

Upload Field

                    [file]
                    label = "Upload a file "
                    display = "UPLOAD"
                    help = "Upload a file to analyze"

Pick Data

                    [data]
                    label = "Pick data"
                    source = "PROJECT"
                    help = "Pick data from this project."

Radio Buttons

                    [species]
                    label = "Select species"
                    display = "RADIO"
                    choices = [ ["c","Cat"], ["d","Dog"] ]
                    value = "c"
                    help = "Select the species."

Name

Recipe display name

Identifier

Unique identifier for the recipe.

Authorization

Determines who can run a recipe.

A detailed explanation of what the recipe does (markdown OK).

Image :

Optional image for the recipe ( 500px Maximum ).

Rank:

Used to order recipes (optional).

Back