Recipe View

How to visualize FASTQ data quality

This recipe performs data quality control on FASTQ data downloaded from SRA.

4 results • updated 10 months ago by Bioinformatics Admin

This recipe performs data quality control on FASTQ data downloaded from SRA.

For more information see the

Bioinformatics Data Analysis online course
Biostar Handbook for system setup and other information.

Copy recipe

You need write access to the original recipe to edit.

# The SRR run number.
SRA={{sra.value}}

# Stop the script on errors.
set -uex

# How many sequences to unpack.
N=10000

# Create directory to store the reads in.
mkdir -p reads

# Download 1000 reads from SRA.
fastq-dump --split-files -X $N -O reads  $SRA

# Make a directory for the fastqc reports
mkdir -p reports

# Run the fastqc report on the sra reads.
fastqc reads/*.fastq -o reports

# Create the adapter sequence used for trimming.
echo ">illumina" > adapter.fa
echo "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" >> adapter.fa

# Run trimmomatic on the data.
trimmomatic PE reads/${SRA}_1.fastq reads/${SRA}_2.fastq -baseout reads/${SRA}.trimmed.fq  ILLUMINACLIP:adapter.fa:2:30:5 SLIDINGWINDOW:4:20

# Run trimmomatic on the trimmed data.
fastqc reads/*.fq -o reports

# Delete the fastqc zip files to reduce clutter.
rm -f reports/*.zip

You need write access to the original recipe to edit.

Click the buttons on the right to create new fields.

Add text field Add float field Add data field Add checkbox Add dropdown Add upload field Add integer field Add radio button

Edit the content of each interface element.

[sra]
label = "SRA Run Number"
display = "TEXTBOX"
value = "SRR519926"
help = "A SRR Run number"

[settings]
id = 97
recipe_uid = "recipe-fastqc"
uid = "recipe-fastqc"
name = "How to visualize FASTQ data quality"
template = "How_to_visualize_FASTQ_data_quality_bio-data-analysis_97.sh"
image = "How_to_visualize_FASTQ_data_quality_bio-data-analysis_97.png"
project_uid = "bio-data-analysis"
url = "http://localhost8000"
help = "This recipe performs data quality control on FASTQ data downloaded from SRA.\n\nFor more information see the \n\n* [Bioinformatics Data Analysis][link] online course\n* [Biostar Handbook][book] for system setup and other information.\n\n[link]: https://www.biostarhandbook.com/edu/course/4/\n[book]: https://www.biostarhandbook.com/"

You need write access to the original recipe to edit.

Name

Recipe display name

Identifier

Unique identifier for the recipe.

Authorization

Determines who can run a recipe.

Image :

Optional image for the recipe ( 500px Maximum ).

Rank:

Used to order recipes (optional).

Insert Image

From the web

From your computer

Cancel

Back