Recipe View

This recipe performs data quality control with the tool cutadapt on microRNA FASTQ data downloaded …

1 result • updated 3.6 years ago by Istvan Albert

This recipe performs data quality control with the tool cutadapt on microRNA FASTQ data downloaded from SRA.

It selects and downloads data deposited for an SRA BioProject, the value is: PRJNA272617

The recipe trims Illumina sequencing adapters from the end of sequences then performs a sliding window approach for correcting trailing low-quality sequences.

The recipe demonstrates other advanced techniques, for example selecting the smallest run from all the sequencing runs deposited for the project while also demonstrating the proper use of automation via loops constructed for parallel.

Finally, quality control reports are generated with fastqc.

For more information see the

Applied Bioinformatics online course
Biostar Handbook for system setup and other information.
The Art of Bioinformatics Scripting for the use of looping

Copy recipe

You need write access to the project to edit.

#
# This recipe works for single end sequencing runs.
#

# Stop on errors.
set -uex

# The bioproject id.
PROJECT=PRJNA272617

# The 3' adapter sequence
ADAPTER=TGGAATTCTCGGGTGCCAAGG

# Get the run information 
esearch -db sra -query $PROJECT | efetch -format runinfo > runinfo.csv

# This will install csvkit if you don't already have it.
pip install csvkit -q

# Get the smallest file, so the download is quickest.
# The ids file contains a single SRR number that corresponds to the smallest file.
cat runinfo.csv | csvcut -x -c Run,size_MB | sort -t , -k 2,2n | grep SRR | cut -f 1 -d ,  | head -1 > ids

# Get the data
cat ids | parallel fastq-dump --split-files -X 10000 {} 

# Run fastqc on each file.
cat ids | parallel fastqc {}_1.fastq 

# Run cutadapt to trim reads on the single end files
cat ids | parallel cutadapt -q 10 -b $ADAPTER {}_1.fastq \> {.}_cutadapt.fq

# With fastqc we're less worried about mismatching files so listing is fine.
cat ids | parallel fastqc {.}_cutadapt.fq

You need write access to the original recipe to edit.

Click the buttons on the right to create new fields.

Add text field Add float field Add data field Add checkbox Add dropdown Add upload field Add integer field Add radio button

Name

Recipe display name

Identifier

Unique identifier for the recipe.

Image :

Optional image for the recipe ( 500px Maximum ).

Rank:

Used to order recipes (optional).

This recipe performs data quality control with the tool cutadapt on microRNA FASTQ data downloaded from SRA.

It selects and downloads data deposited for an SRA BioProject, the value is: [PRJNA272617] [PRJNA272617]

[PRJNA272617]: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA272617

The recipe trims Illumina sequencing adapters from the end of sequences then performs a sliding window approach for correcting trailing low-quality sequences.

The recipe demonstrates other advanced techniques, for example selecting the smallest run from all the sequencing runs deposited for the project while also demonstrating the proper use of automation via loops constructed for `parallel`.

Finally, quality control reports are generated with `fastqc`.

For more information see the

* [Applied Bioinformatics online course][course] 
* [Biostar Handbook][book] for system setup and other information.
* [The Art of Bioinformatics Scripting][art] for the use of looping

[course]: https://www.biostarhandbook.com/edu/course/6/
[art]: https://www.biostarhandbook.com/books/scripting/index.html
[book]: https://www.biostarhandbook.com/

Insert Image

From the web

From your computer

Cancel

Back

How to trim adapters from microRNA data

Insert Image