Result List

Results for Variant calling with bcftools: AF086833, SRR1972739

Results generated by running the recipe.

Completed

• Runtime 10 seconds • updated 16 months ago by Istvan Albert

Results for Variant calling with freebayes: AF086833, 100000

Results generated by running the recipe.

Completed

• Runtime 2 seconds • updated 16 months ago by Istvan Albert

Results for Variant calling with bcftools: AF086833, SRR1972739

Results generated by running the recipe.

Completed

• Runtime 10 seconds • updated 16 months ago by Istvan Albert

Results for Alignment based RNA-Seq

Results generated by running the recipe.

Completed

• Runtime 27 seconds • updated 2.3 years ago by Istvan Albert

Results for A curious case of variant calling errors

Results generated by running the recipe.

Completed

• Runtime 4 seconds • updated 2.3 years ago by Istvan Albert

Results for Mission Impossible: Multi Sample Variant Calling in 60 seconds: PRJNA257197, KJ660346, 5

Results generated by running the recipe.

Completed

• Runtime 40 seconds • updated 2.3 years ago by Istvan Albert

Results for How to run the BWA short read aligner: AF086833, SRR1972739

Results generated by running the recipe.

Completed

• Runtime 11 seconds • updated 2.3 years ago by Istvan Albert

Results for Bacterial variant calling with filtering: NZ_CP008918, SRR4124989

Results generated by running the recipe.

Completed

• Runtime 1 minutes • updated 2.3 years ago by Istvan Albert

Results for Large Scale Genomic Variation: AF086833

Results generated by running the recipe.

Completed

• Runtime 1 seconds • updated 2.4 years ago by Istvan Albert

Results for How to download sequencing data via Entrez Direct: PRJNA272617, AF086833

Results generated by running the recipe.

Completed

• Runtime 8 seconds • updated 2.4 years ago by Istvan Albert

Results for How to run the BOWTIE short read aligner: AF086833, SRR1972739

Results generated by running the recipe.

Completed

• Runtime 8 seconds • updated 2.4 years ago by Istvan Albert

Results for How to run the BWA short read aligner: AF086833, SRR1972739

Results generated by running the recipe.

Completed

• Runtime 12 seconds • updated 2.4 years ago by Istvan Albert

Results for How to create and query a custom BLAST database

Results generated by running the recipe.

Completed

• Runtime 19 seconds • updated 2.4 years ago by Istvan Albert

Results for How to inspect the contents of a BLAST databases

Results generated by running the recipe.

Completed

• Runtime 3 seconds • updated 2.4 years ago by Istvan Albert

Results for How to use BLAST to identify a viral sequence

Results generated by running the recipe.

Completed

• Runtime 11 seconds • updated 2.4 years ago by Istvan Albert

Results for How to trim adapters from paired end FASTQ data: SRR519926

Results generated by running the recipe.

Completed

• Runtime 19 seconds • updated 2.4 years ago by Istvan Albert

Results for How to trim adapters from microRNA data: PRJNA272617, TGGAATTCTCGGGTGCCAAGG

Results generated by running the recipe.

Completed

• Runtime 14 seconds • updated 2.4 years ago by Istvan Albert

Results for Lecture 10: Quality control of sequencing data: SRR519926

Results generated by running the recipe.

Completed

• Runtime 23 seconds • updated 2.5 years ago by Istvan Albert

Applied Bioinformatics Course Recipes